Cell Structure and Functions

Cytology is the study of cells, which are tiny building blocks that make up every living thing. You have already learned about the different parts of a cell, but now we are going deeper.

We will explore how cells transport things in bulk, such as tiny packages moving in and out. Discussions on the structure of the DNA will be done, the Watson - Crick Model of DNA will be examined in terms of its essential components and then followed with the importance of the DNA to living things. We will also learn about DNA and RNA, being the blueprints of life that control how cells build proteins.

The study of cells is important because it helps us understand how our bodies work and can even lead to breakthroughs in things like healthcare and farming

KEY IDEAS

• The study of the cell is guided by the cell theory, which has three components.

• Some cells have developed adaptations to perform specific functions.

Based on these functions or roles, they are referred to as specialised cells.

• Active transport involves the movement of molecules or ions across a cell membrane from an area of lower concentration to an area of higher concentration using energy from the cell.

• DNA and RNA are the two main types of nucleic acids which are biopolymers that carry genetic information from living organisms to their offspring.

• A nucleotide is made up of a five-carbon sugar, called a pentose sugar, a nitrogenous base: adenine (A), thymine (T), cytosine (C), guanine (G), or uracil, (U), and a phosphate group.

• DNA replication is essential for cell division, ensuring that each new cell receives a copy of the organism’s genetic material and occasionally, errors occur during the replication leading to mutations.

• DNA replication ensures that genetic information is passed from parents to their offspring during reproduction.

• RNA is a single–stranded nucleic acid found in the cytoplasm and the nucleus of living organisms and is in three types (mRNA, tRNA and rRNA), each with specific functions.

• Transcription is the process by which a molecule of RNA is formed using a strand of DNA as a template.

• The genetic code refers to the set of rules by which the sequence of nucleotides in DNA or RNA is translated into an amino acid sequence of proteins in living cells.

The Cell Theory

Cells are tiny building blocks that make up all living things. Some living things are made of just one cell, while others, like plants and animals, are made of many cells.

This lesson will look at two types of cells:

1. Prokaryotic cells: These are simple cells, like bacteria, without a nucleus.

2. Eukaryotic cells: These are more complex cells, like plant and animal cells, with a nucleus and other tiny parts called organelles.

The Cell Theory tells us three very important facts:

a. Everything alive is made of cells

b. Cells are the basic building blocks of life

c. Cells come from other cells No matter how big or small an organism is, if it is alive, it is made of cells. Just as a house is built with bricks, all living things are built with cells and new cells are made when old cells divide. Understanding the Cell Theory helps scientists learn more about how living things work, and that helps us develop new medicines and ways to improve our lives.

Cell Structure

Figure 2.1: Structure of an Animal Cell

Figure 2.2: Structure of a bacterial cell

Figure 2.3: Structure of a Plant Cell

One of the key distinctions between plant and animal cells lies in their structure and the organelles they possess. Plant cells, typically more rigid, have a sturdy cell wall made of cellulose that provides structural support and gives the cell a fixed shape. Additionally, they contain chloroplasts, which contain chlorophyll used for trapping sunlight for the process of photosynthesis. Many plant cells have a permanent large central vacuole used to store water, pigments and nutrients. On the other hand, animal cells lack a cell wall, chloroplasts, and a central vacuole as prominent as that found in plant cells. Animal cells have lysosomes that contain enzymes responsible for the digestion of macromolecules, old cell parts, and microorganisms.

Organelles found in both plants and animal cells are mitochondrion, golgi apparatus, smooth and rough endoplasmic reticulum, ribosomes and peroxisomes.

Activity 2.1 Build a Cell City

Imagine a cell as the community you live in. This community has many parts or areas, and they work together for its progress or development, just as the different parts within the cell.

What you need:

• Big paper or cardboard

• Markers, crayons, or pencils

• Old magazines (optional) Let us do it

1. Think like a city planner: As a class, let us name different parts of our community (such as the Chief’s palace, the library, a power station, roads, and the post office).

2. Cell City Match Up: Now, let’s imagine those city parts are like parts inside a cell:

a. Chief’s palace: This is like the nucleus, the boss of the cell.

b. Library: This is like DNA, holding important information for the cell.

c. Power Station: This is like the mitochondria, giving the cell energy.

d. Roads: These are like the endoplasmic reticulum, moving things around the cell.

e. Post Office: This is like the Golgi apparatus for transporting, modifying, and packaging proteins and lipids into vesicles for delivery to targeted destinations.

3. Teamwork Time: Split into groups. Each group gets a different cell part.

4. Get Creative: Each group will draw and colour their cell part on their paper or cardboard.

5. Show and Tell: Each group will show their “Cell City” part to the class and explain what makes it a part of it and its role.

The Big Idea:

• Just as our community needs all its parts to work, a cell also needs all its parts to work.

• Each tiny part of the cell has a big job to do to keep it alive.

• Everything alive, from tiny ants to tall trees, is made of cells.

This activity helps you see how amazing cells are, even though they are microscopic.

Specialised Eukaryotic Cells and Their Adaptations

Some cells have specific adaptations for performing specific functions or roles.

These are called specialised cells.

Let us look at some specialised plant cells:

1. Epidermal cells: These cells are from the outer protective layer (epidermis) of the plant, acting like skin. They help prevent water loss and protect against pathogens.

2. Palisade mesophyll cells: Located just beneath the epidermis, these cells are rich in chloroplasts. They absorb sunlight to carry out photosynthesis, producing food for the plant.

3. Spongy mesophyll cells: Found below the palisade layer, these cells have spaces between them that allow for gas exchange. They help the plant take in carbon dioxide and release oxygen.

Figure 2.4: Specialised cells in the leaf

4. Root hair cells: These specialised cells extend from root surfaces and increase the surface area for absorption. They are crucial for taking in water and nutrients from the soil.

5. Root tip cells: These cells are located at the growing tips of roots. They are actively dividing, allowing the roots to grow longer and spread out through the soil, resulting in a large surface area for the absorption of water and minerals.

6. Guard cells: These cells surround the stomata (small openings on the leaf surface). They control the opening and closing of these stomata, regulating gas exchange and water loss.

Each type of cell plays a unique role in helping the plant function effectively, from protecting it to facilitating essential processes like photosynthesis and mineral absorption.

Figure 2.5: Root Hair Cell

Now, let’s look at some specialised animal cells:

1. Muscle cells: These cells are specialised for contraction and movement.

There are three types: skeletal (voluntary movement), cardiac (heart muscle), and smooth (involuntary movement in organs). They help the body move and maintain posture.

2. Sperm cells: These are male reproductive cells. They are designed for mobility with a tail (flagellum) that allows them to swim towards the egg for fertilisation.

3. Egg cell: These are female reproductive cells. They are larger than sperm and contain nutrients to support the early development of an embryo after fertilisation.

4. Red blood cells: These cells transport oxygen from the lungs to the rest of the body and carry carbon dioxide back to the lungs for exhalation. They contain haemoglobin which gives blood in mammals its red colour. The haemoglobin binds to oxygen and carries it to the cells where they are released for use by the cells in respiration.

5. White blood cells: These cells are part of the immune system. They help protect the body against infections and foreign invaders. There are several types of white blood cells, each with a specific role in fighting off diseases.

Each type of cell has a specialised function that contributes to the overall health and functioning of the body, from movement and reproduction to oxygen transport and immune defence.

Figure 2.6: Sperm Cell

Figure 2.7: Red blood cell Figure 2.8: Types of muscle cells

Activity 2.2 Specialised cells and adaptations

1. Pick an elbow friend or partner.

2. Each of you should write about two specialised cells of plants along with their adaptations.

3. Each of you should write about two specialised cells of animals along with their adaptations.

4. Take turns to discuss with your colleague what you wrote.

Note

Write each other’s responses and submit them to your teacher.

Active Transport

In JHS, you studied diffusion and osmosis, which are passive ways by which substances such as water and ions move in and out of cells. Another mechanism by which substances move into and out of cells is by active transport. This is the movement of molecules or ions from an area of lower concentration to an area of higher concentration across a cell membrane with the use of energy provided by the cell. In this process, substances move against a concentration gradient into cells. This means, instead of substances moving from a high to a low concentrated region, movement rather occurs from a low to a high concentrated region. This movement requires energy in the form of ATP.

Typical examples of active transport in animals include the sodium- potassium pump that moves ions in nerve cells, the proton pump that moves ions in the stomach lining, selective reabsorption in the kidney tubules and the secretion of enzymes, hormones and antibodies from cells.

In plants, a typical example of active transport is the uptake of water and mineral salts from the soil by the root hair cells, the proton pump to regulate pH and solute transport in phloem cells.

Endocytosis This is the process by which cells take in substances from outside the cell by engulfing them with a portion of their cell membrane. The steps involved in endocytosis are:

1. Recognition- the cell identifies a substance outside of it

2. Invagination- the cell membrane folds inwards, forming a pocket structure with the substance within.

3. Vesicle formation- the cell membrane surrounding the substance breaks off into the cytoplasm.

4. Internalisation or vesicle transport – vesicle(endosome) into the cell with substance in it, and is transported to various parts of the cell.

Endocytosis helps the cell to:

a. Absorb nutrients and proteins

b. Regulate the action of the cell surface

c. Defend against pathogens and toxins

d. Maintain cell membrane recycling.

Types of Endocytosis

1. Phagocytosis involves taking in or engulfing large particles such as bacteria and dead cells and transporting them into its inner space. For example, macrophages (white blood cells) engulf bacteria and other foreign bodies and digest them. Phagocytosis is also called “cell eating” because of the solid nature of the substance engulfed by the cell.

2. Pinocytosis, also known as ‘cell drinking’, involves the uptake of small molecules or fluids. An example is the absorption of nutrients from fluids passing through the kidney tubules.

Figure 2.9: Types of Endocytosis

Exocytosis This is the process by which cells release substances from within them to the outside. The processes involved in exocytosis include:

1. Vesicle Transport: Vesicles with the materials to be expelled move to the cell membrane.

2. Docking: Vesicles align and bind to the cell membrane.

3. Fusion: Vesicles merge with the cell membrane to release contents.

4. Release: molecules are released outside the cell.

Exocytosis is important in:

1. hormone secretion (e.g. insulin release from pancreatic cells)

2. neurotransmitter release from neurons.

3. waste removal

4. cell signalling

5. immune response (release of antibodies)

Figure 2.10: A cell carrying out exocytosis

Activity 2.3 Demonstration to illustrate endocytosis and exocytosis using balloons Materials needed

• Balloons (various colours)

• Small objects to represent cellular cargo (substances), e.g. beads, small toffees,

• Tape or string

• Scissors

• Whiteboard or chart paper Procedure

1. Blow up your balloon and tie it up to represent a cell membrane.

Note: Do not blow up to be hard.

2. Place the small object (cargo) near the balloon.

3. Use a tape or string to create a small pocket in the balloon (simulating the cell membrane invaginating)

4. Engulf the cargo by wrapping the balloon around it.

5. Twist and tie the balloon to send the cargo inside, representing endocytosis.

6. Discuss with your friends how cells internalise substances through endocytosis.

Demonstrating exocytosis with a balloon

a. Blow up another balloon with the cargo (beads, small toy or toffee) already inside.

(This represents a vesicle filled with waste or excess substances)

b. Place the balloon with cargo near another balloon representing the cell membrane.

c. Use tape or string to attach the two balloons, simulating vesicle fusion.

d. Slowly release the air from the inner balloon, allowing the cargo to exit.

e. Now, discuss with your friends the following points:

• Similarities and differences between endocytosis and exocytosis.

• Explain the importance of these processes in maintaining an internal balance of cells.

In the nucleus of eukaryotic cells are thread-like structures called chromosomes.

The chromosomes appear as two strands and each strand is called a chromatid.

The two chromatids which are identical are joined at the centromere.

Figure 2.11: Three-dimensional structure of the Chromosome.

The chromosomes contain Deoxyribonucleic Acid (DNA) that carries the genetic information for organisms and is transferred to offspring. The DNA is an organic molecule that is made up of nucleic acids that carry genetic instructions used in growth, development, functioning and reproduction of all living things.

Nucleic acids are long-chain polymeric molecules (biopolymers), the monomer (the repeating unit) is known as a nucleotide, and hence sometimes nucleic acids are referred to as polynucleotides. Nucleic acids were discovered by a Swiss biologist and physician called Friedrich Miescher in 1869. The two main types of nucleic acids are DNA and RNA (ribonucleic acid).

Each nucleotide is made of three parts:

1. Pentose sugar: five-carbon sugar (this is deoxyribose in DNA and ribose in RNA)

2. Nitrogenous base: adenine (A), thymine (T), cytosine (C), guanine (G) and uracil(U)

3. Phosphate group/phosphoric acid (a molecule with one phosphorus atom bonded to four oxygen atoms) The phosphate group of one nucleotide is linked to the pentose sugar of the next nucleotide by a phosphodiester bond. This bonding occurs between many nucleotides to form a long chain called a polynucleotide. Hydrogen bonding occurs between the nitrogenous bases to form a ‘ladder’ of two polynucleotides.

The polynucleotide chains coil around each other to form a double helix, forming the DNA.

Figure 2.12: Structure of the DNA

DNA is found in the nucleus (of a eukaryotic cell as a complete set of genes), mitochondrion (mtDNA), with fewer genes for energy production, and chloroplasts (cpDNA) and in some algal cells.

Click on the link below for an interactive look at DNA https://www.labxchange.org/library/items/ lb:LabXchange:5e1fcef1:lx_simulation:1 Watson-Crick Model of DNA A representation of the structure of DNA is proposed in models, and the most common model is the Watson-Crick model. This model was proposed by James Watson and Francis Crick in 1953 by analysing X-ray crystallography data. The essential aspects in the model are as follows:

1. The DNA is composed of two antiparallel strands coiled around a central axis (forming a double helix structure).

2. There is a complementary base pairing of the nitrogenous bases, where adenine pairs with thymine, and guanine pairs with cytosine (that is, A-T and G-C) by hydrogen bonds.

3. The two DNA strands show antiparallel orientation (run in opposite directions, that is, 5’ to 3’ and 3’ to 5’, read as 5 to 3 direction, and 3 to 5 direction).

4. A sugar-phosphate backbone is formed by a phosphodiester bond between the pentose sugar and phosphate group.

5. Major and minor grooves are formed in the helical twist between the two DNA strands, and these grooves provide spaces (points of attachment) for enzymes and proteins and other molecules to bind to the DNA.

Figure 2.13: Watson-Crick model of the DNA The significance of DNA in a eukaryotic cell DNA is a life molecule; its presence in cells is very important because:

1. It stores genetic information with instructions for development, functioning and reproduction in living things.

2. It transmits genetic information from one cell to another by replicating or doubling itself before cell division.

3. It carries genetic codes called genes on the chromosomes that specify sequences of amino acids for protein synthesis.

4. Changes in genetic sequences of DNA are called mutations, which serve as the basis for evolution and the adaptation of organisms to new environments.

Activity 2.4 DNA graphic organiser

1. Create a graphic organiser for DNA that best fits the structure of the DNA.

2. There should be boxes or shapes connected with labelled arrows.

3. Information in the boxes, shapes or on the arrows may be words or phrases linked to the structure of the DNA, e.g. DNA ladder, base pairs, double helix, backbone, pentose sugar, nitrogenous bases, phosphodiester bond, single strand, etc.

4. Use a computer (MS word, paint, etc) or by hand on a plain paper to draw the graphic organiser.

Note

Graphic organisers are visual thinking tools that make pictures of your thoughts. The pictures demonstrate relationships between facts, concepts, or ideas, and guide your thinking as you design the map or diagram. This is an

example of a graphic organiser

Activity 2.5 Designing a DNA model

1. Gather materials like sheets of paper, manila cards, cardboard, coloured beads, different types and shapes of seeds, glue, pins, straws, etc.

2. Plan on how to use the gathered materials to design a model of the DNA structure

3. Design models of DNA using the materials gathered.

4. Outline the importance of DNA on a chart.

5. Display your model and the chart in class and explain to your peers the various components.

DNA Replication

Let us consider what DNA replication entails. DNA replication is the process through which a cell creates exact copies of its DNA molecules. This crucial

activity occurs during the S phase or synthesis phase of the cell cycle, which is part of interphase before a cell divides.

The process of DNA replication involves three main steps. These are:

1. Unwinding or Opening the Double Helix: First, the DNA double helix unwinds, and the two strands separate, like unzipping a zipper.

2. Adding Primers: Once the strands are apart, short RNA sequences, known as primers, are attached to the template strands. These primers serve as starting points for building new DNA strands.

3. Building New DNA Strands: In the last step, the cell adds nucleotides (the basic units of DNA) to the primers, resulting in the formation of two new identical DNA molecules.

This entire process is essential for ensuring that each new cell receives genetic information from the original cell. This is demonstrated in the activity below

Activity 2.6 Demonstration of the Processes of DNA Replication

1. Use a zipper or string to show how the DNA double helix unwinds.

Activity: In pairs, take two long strips of coloured paper to represent the DNA strands. Have one student hold each end and slowly “unzip” the strands while explaining this step.

Discussion: Share what you think happens at this stage and why unwinding is important.

2. Use small pieces of paper or sticky notes to represent RNA primers.

Place the sticky notes on the template strands at various points, simulating where primers would attach.

Discuss the role of primers in starting the replication process.

3. Use coloured beads or small blocks as nucleotides.

In turn, add nucleotides to the RNA primers, selecting colours to represent the different bases (A, T, C, G).

Form groups to create two new strands of DNA by matching the nucleotides to the template strands and explain the base pairing rules as you go.

Discuss how the new strands are formed and the importance of accuracy in this process.

Detailed activities or steps of DNA Replication DNA replication is a highly coordinated process that ensures the accurate copying of genetic information, allowing cells to divide and pass on their DNA to the next generation.

1. Initiation: Replication begins at specific locations on the DNA molecule called origins of replication, where the DNA double helix is recognised by initiator proteins.

2. Unwinding: The enzyme DNA helicase unwinds the double-stranded DNA, separating the two strands to form the replication fork.

3. Stabilisation: Single-stranded binding proteins attach to the separated strands to prevent them from re-annealing or forming secondary structures.

4. Priming: The enzyme DNA primase synthesises short RNA primers on the template strands, providing a starting point for DNA synthesis.

5. Elongation: DNA polymerase adds nucleotides to the growing DNA strand, extending from the RNA primer and synthesising the new strand in the 5’ to 3’ direction.

6. Synthesis of Okazaki Fragments: On the lagging strand, DNA polymerase synthesises short segments of DNA called Okazaki fragments, which are created in the opposite direction of the replication fork.

7. Removal of Primers and Fragment Joining: RNA primers are removed by DNA polymerase, which fills in the gaps with DNA. DNA ligase then seals the Okazaki fragments together to create a continuous strand.

8. Termination: The replication process concludes when the replication forks meet termination sequences, signalling the end of DNA synthesis.

This sequence of activities ensures that each new cell receives an accurate and complete set of genetic instructions. These steps work together to ensure that each new cell gets a complete set of DNA.

Figure 2.14: DNA Replication

Click on the link below to watch the short video on DNA Replication.

DNA Replication (Updated) (youtube.com)

Activity 2.7 Exploring DNA Replication

Materials Needed

• Access to videos, PowerPoint presentations, and simulations about DNA replication.

• Notebooks or digital devices for notetaking.

Instructions

1. Watch selected videos or PowerPoint presentations on DNA replication.

2. Discuss after viewing the content, focusing on:

a. Key concepts of DNA replication.

b. The roles of different enzymes.

c. Any questions or points of clarification?

3. Share your thoughts, ensuring that all voices are heard and respected.

4. Summarise your discussion points and share with the class.

Title: Timeline of DNA Replication

Materials Needed

• Large paper or poster boards.

• Markers, coloured pencils, and other art supplies.

• Access to information resources (books, articles, or online sources).

Instructions

a. Research on the stages of DNA replication: Initiation, Elongation, and Termination.

b. Create a timeline chart that includes:

• Clear labels for each stage.

• Descriptions of what happens in each stage.

• Illustrations or icons representing key processes or enzymes involved.

c. Include a section on how DNA replication relates to real-world scenarios, such as genetic inheritance or cloning.

d. Present your timelines to the class, explaining the stages and their significance.

Relevance of DNA replication to living organisms DNA replication plays a crucial role in the life of all organisms.

1. First and foremost, it enables the transfer of genetic information from one generation to the next. This transmission is essential for the continuity of species.

2. Additionally, DNA replication is vital for maintaining the stability of genetic information. If errors occur during replication, they can lead to harmful changes that may affect the organism’s health and development, leading to mutations.

3. Furthermore, DNA replication is a source of evolution through mutations.

While many mutations can be detrimental, some can lead to advantageous traits that may help species adapt to their environments over time.

4. In the process of cell division, particularly mitosis, DNA replication ensures that the daughter cells produced are identical and have the same genetic material. This is important for growth, development, and the repair of tissues.

5. Finally, DNA replication is essential for producing gametes, which contain half the set of chromosomes needed for sexual reproduction.

In summary, DNA replication is fundamental to the survival and evolution of living organisms, affecting everything from heredity to cellular function.

The RNA Molecule

RNA (Ribonucleic acid) is an important molecule found in all living cells. It is a single-stranded molecule, unlike DNA, which is double-stranded. The building blocks of RNA are nucleotides. Each nucleotide is composed of a five-carbon (pentose) sugar called ribose, a phosphate group and nitrogenous or organic bases: Adenine (A), Cytosine (C), Guanine (G) and Uracil (U); here, U replaces T found in DNA. It can be found in either the nucleus or the cytoplasm of the cell. The main types of RNA are messenger RNA (mRNA), which carries genetic information from the DNA to ribosomes for protein synthesis. In this process, it serves as a template. Ribosomal RNA (rRNA) makes up a large part of ribosomes.

Transfer RNA (tRNA) brings amino acids to ribosomes during protein synthesis.

RNA plays key roles in biological processes such as protein synthesis, genetic information transmission, regulation of gene expression (the processes by which cells control the conversion of genetic information from DNA to RNA and then to proteins) and in the immune system (e.g. RNA interference)

Figure 2.15: Structure of the RNA molecule

Activity 2.8 “RNA uncovered” Materials needed

• Whiteboard or any presentation software

• Markers or a digital drawing tool

• Printed or digital diagrams of RNA structure

• Plain paper and coloured pencils (optional) Procedure

1. Form a small group with your friends and assign a leader to facilitate discussions.

2. Gather information from textbooks, articles and online resources on RNA, focussing on what RNA is, its composition and its functions (note down your findings from your search).

3. Now with your friends, create a visual representation in the form of a diagram, poster or infographic, illustrating RNA’s composition (the composition should include the sugar molecule, phosphate groups and nitrogenous bases. Employ your creative skills to make a near-perfect diagram of the RNA molecule.

4. Present your visual representation to the rest of the class for feedback and questions (this process will help increase your understanding of the RNA molecule).

5. Finally, reflect on what you have learnt from the activity and summarise your key points in your notebook (you may paste your diagram on the wall of your classroom for quick reference).

Activity 2.9 RNA Structure Simulation

(NB: Going through this activity will help you develop problem-solving and critical thinking skills through model creation. Have fun building your RNA model!)

Materials needed

• Wire (copper or aluminium)

• Beads (different colours)

• Styrofoam balls (or small balls of clay)

• Straw

• Cardboard

• Scissors

• Glue

• Tape

• Markers or paint Procedure

1. Cut the wire into desired lengths for the phosphate backbone,

2. Assign each bead to represent a particular organic base e.g. Adenine(A) red, Guanine(G) blue, Cytosine(C) yellow, Uracil(U) green.

3. Use the Styrofoam balls or clay to represent sugar molecules.

4. Bend the wire to form the phosphate backbone.

5. Use glue or tape to secure the wire shape.

6. Attach Styrofoam balls or clay representing sugar molecules to the backbone.

7. Use the straw to attach the bases to the sugar molecule.

8. Thread beads onto the straw and attach to the sugar molecule on the wire backbone, following the correct order of base pairing.

9. Use markers or paint to label the nucleotides on the cardboard.

10. Create a key or legend to explain the colours used.

11. Mount your model on the cardboard, display it to the rest of the class, and receive feedback from your teacher and colleagues.

RNA and Its Transcription

Transcription is the process by which an RNA strand is created from a template of DNA. The steps involved in the process are as follows:

1. Initiation: In this step, RNA polymerase binds to DNA at a promoter region, causing the double helix of the DNA to unwind, exposing a template strand.

2. Elongation: In this step, RNA polymerase reads the template strand and matches or aligns with complementary nucleotides. Synthesis of RNA occurs in the 5’ to 3’ direction.

3. Termination: Here, RNA polymerase reaches a termination sequence.

Transcription ends, and RNA is released.

4. RNA processing: This is where the primary RNA (pre-mRNA) transcript undergoes several modifications to become mature mRNA. This is usually the case with RNA production in eukaryotes.

After pre-mRNA has been formed, it undergoes modifications to form the mature RNA. These modifications (post-transcriptional processes) include:

a. Splicing: removing introns (non-coding regions or sequences) and joining exons (coding regions or sequences).

b. Capping: adding a 5’ cap to mRNA protects it and enhances ribosome binding.

c. Polyadenylation: adding a poly-A tail to mRNA at the 3’ end to protect it and aid its transport from the nucleus.

NB: In RNA (and DNA as well), the 5’ and 3’ notation refers to the orientation and direction of the nucleic acid chain. The 5’ end is the beginning of the RNA chain, where the phosphate group is attached to the fifth carbon of ribose, while the 3’ end is the opposite end of the RNA chain, where the hydroxyl group is attached to the third carbon atom of the ribose sugar.

The importance of these modifications ensures that RNA is correctly synthesised and ready for protein synthesis as well as other cellular functions.

Figure 2.16: RNA Transcription

Relevance of RNA (transcription) to Living Things

Here is a summary of some of the relevance of RNA in living things:

1. Protein synthesis and genetic expression: RNA plays a crucial role in translating genetic information from DNA into proteins. mRNA also carries genetic information from the DNA to the ribosomes.

2. Cellular defence and immune response: RNA molecules help protect cells against pathogens and viral infections such as influenza.

3. Regulation of cellular processes: Apart from regulating gene expression, RNA molecules also influence cell growth, differentiation and survival.

4. Development, growth and adaptation: RNA directs embryonic development, tissue formation and organ development in the early stages of life. RNA molecules also drive evolutionary changes through mutations.

5. Therapeutic and biotechnological applications: RNA-based therapies such as mRNA vaccines could be used in future, with further research, to treat genetic disorders, cancer and infectious diseases such as Hepatitis C, COVID-19, Ebola and HIV.

Activity 2.10 RNA Transcription from DNA to RNA Materials needed

• Large sheet of paper

• Markers of coloured pencils

• Printed diagrams of DNA and RNA structures (optional)

• Sticky notes or paper tape.

Procedure

1. Team up with some of your friends to create a visual representation (e.g. diagram or illustration) of any of the stages of transcription, e.g.

initiation. Note that other groups will be working on the other stages of transcription.

2. Present your visual representation to the class and explain your creative design. Accept feedback from peers and your teacher.

3. Listen to the explanation of other peers with visual representations of other stages of transcription. Provide feedback questions for clarity where necessary.

4. Now work together with members of other groups to arrange all the visual representations in the correct order, i.e. initiation→ elongation, etc.

5. In groups, take turns to discuss and explain how each stage connects to the next.

You may put your visual representation on display in your classroom or laboratory or keep it in a safe cupboard for display on a science exhibition day!

Activity 2.11 Significance of RNA Transcription

1. Search the internet, textbooks, articles and other resource materials, relevance of RNA transcription in living things.

2. Note down your findings in your notebook.

3. Compare your findings with those of your friends and discuss the relevance written by each of you.

NB: You may confer with your teacher for further clarification

The Genetic Code

Now let us look at what is called the Genetic code. The nucleotides in the DNA (adenine (A), cytosine (C), guanine (G) and thymine (T)) are arranged in a variety of sequences that is copied by the mRNA’s nucleotides (A, U, C, and G). This encoded sequence of genetic message carried by the four bases A, U, C and G in the mRNA is decoded (translated or converted into meaningful language) by tRNA.

The Genetic code refers to the set of rules by which the sequence of nucleotides in DNA or RNA is translated into an amino acid sequence of proteins in living cells. A group of three bases (triplet base) called a codon specifies which amino acid is needed at each position within a protein. There are 64 different forms of codons. This is because each codon is three nucleotides long, and there are four possible nucleotides for each position; the total number of possible combinations is 4 x 4 x 4 = 64. 61 of these codons can each code for one amino acid. There are 20 different kinds of amino acids that these codons specify. Let’s see a table of these codons and their corresponding amino acids

Figure 2.17: mRNA codons for all amino acids found in human proteins.

A start codon is the codon that initiates or directs the first amino acid to start the formation of a chain of amino acids (protein). Three of the codons, UGA, UAA and UAG, do not code for any amino acids and are therefore called nonsense codons. Nonsense codons are also referred to as stop codons because they mark the end (termination) of protein (the polypeptide chains) whenever they occur.

The genetic code is described as universal because a triplet of bases codes for the same amino acid in almost all organisms. It is also said to be degenerate because each amino acid has more than one codon. The triplet of bases on tRNA which is complementary to a codon on the mRNA is called the anticodon.

Protein Synthesis and Its Mechanism

Now let us form some proteins: the process by which cells build proteins to be used in the body of an organism for growth and development is called Protein synthesis.

Protein synthesis in living things occurs in two major stages: transcription and translation.

Transcription In this process a segment of DNA is copied by free nucleotides in the nucleus to form mRNA and is catalysed by the enzyme RNA polymerase. mRNA serves as a temporary copy of the genetic information from the DNA. This takes place in the nucleus of the cell. The mRNA formed leaves the nucleus into the cytoplasm through the nuclear pores, it attaches itself to a ribosome. This ends the process of transcription. The next stage is Translation.

Translation This is the stage where the genetic information is copied (transcribed) into mRNA paired or matched to the tRNA and transformed into a sequence of amino acids to form proteins. This activity occurs on the ribosomes within the cytoplasm in three steps:

1. Initiation: This is the first stage,

• A ribosome surrounds a mRNA and an initiator tRNA carrying the amino acid (methionine). It is on this ribosome that the amino acid chain will be formed.

• The tRNA attached to the small ribosome binds to the 5’ end of the mRNA.

• They then move along the mRNA in the 3’ direction, stopping when they reach the start codon (AUG).

• This start codon AUG binds with anticodon UAC on the tRNA, which is carrying the amino acid, methionine.

2. Elongation: This is where the ribosome adds more amino acid molecules brought by tRNA to the growing polypeptide chain.

• tRNA picks the amino acids from the cytoplasm to be assembled on the ribosomes.

• A fresh codon is exposed for the next tRNA, whose anticodon is a perfect (complementary) match for the exposed codon

• Once the matching tRNA pairs on the mRNA, the formation of the peptide bond that connects one amino acid to another begins.

• This next step transfers the methionine from the first tRNA onto the amino acid of the second tRNA. We now have two amino acids, a (very tiny) polypeptide.

• Once the peptide bond is formed, the mRNA is pulled onward through the ribosome by exactly one codon. This shift allows the first, empty tRNA to drift out.

• A new codon is exposed, so the whole cycle can repeat, till the tRNA encounters a stop codon on the mRNA.

3. Termination: at this stage the synthesis of a polypeptide chain ends. This happens when

• The ribosome on which the protein is being formed encounters a stop codon on the mRNA.

• The newly formed polypeptide chain is released into the cytoplasm.

• The new polypeptide joins other chains of polypeptides to form the protein.

• The ribosomal subunits then disassemble.

Figure 2.18: Formation of polypeptide chain (protein) The pink balls in the diagram above represent the amino acids Relevance of Proteins to Living Things The process of protein synthesis in cells is crucial because the proteins formed are:

1. Essential for growth, development and repair of tissues in living things.

2. Used in the production of enzymes to catalyse biochemical activities.

3. used in communication between cells (e.g. hormones) and the regulation of cellular activities.

4. are required in the immune system to defend the body, e.g. antibodies and cytokines

5. required in the transport and storage of materials in cells (e.g. haemoglobin).

6. required to maintain cell shape, cell structure and cell motility, e.g. actin and tubulin.

Activity 2.12 Transcription Simulation

Materials needed

• Paper/notebook

• Pens.

Instructions:

1. Use the DNA template strand as provided and decode its corresponding mRNA.

DNA strand 3’TGATACGTTGCCCCTACTAAT 5’

2. Write out the transcribed DNA sequence into mRNA by noting down the complementary RNA bases.

3. Show your final mRNA strand sequence to a friend or teacher to check it out.

Activity 2.13 Protein Synthesis Animation or Storyboard

Materials needed

• Computer

• Animation software or online tools, or a manila card

• Different coloured markers

• Tapes.

Instruction: Create a simple animation or storyboard that illustrates the steps of transcription and translation.

How to create a storyboard

1. Determine the key concepts you want to cover: DNA transcription, mRNA processing, translation, etc.

2. Break down each process of protein synthesis (key concepts) into clear, manageable parts.

3. Create scenes for each part of the process. Each scene should represent a specific step or key event in protein synthesis.

4. For each scene, draw a frame that represents the main action. Use simple sketches or diagrams to illustrate key elements (e.g., DNA, RNA polymerase, ribosomes, tRNA, amino acids).

5. Write a brief description under each frame explaining what is happening.

Include key terms and concepts.

6. Arrange the frames in sequential order, ensuring the flow makes sense and each step logically follows the previous one.

7. Check for accuracy and clarity.

Note: You may use any software or tools of your choice. You may work as a team with class members.

Activity 2.14 Build a Protein Chain

Materials needed

• Beads of different colours

• String.

Instructions

1. Assign each bead colour to a different amino acid.

2. Use a codon chart (in in text above) to translate an mRNA sequence (you can use the mRNA developed in Activity 2.11) into a chain of beads, forming a protein.

• Biology GAST Textbook

• Cambridge Biology

• College Biology

• McFadden, C.H. & Keeton, W.T. (1995). Biology: An exploration of life.

(5th edition). W.W. Norton & Company, Inc., New York.

• Online Biology Resources

• Roberts, M.B.V. (1982). Biology: A Functional Approach. (3rd edition).

Butler &Tanner Ltd.

1. What are the fundamental principles that define the cell theory?

2. Explain how the unique structure of these cells helps it perform its specific function: nerve cell, red blood cell. Muscle cell, palisade mesophyll cell, root hair cell and xylem cell.

3. How do the structures of plant and animal cells differ, and how do these differences reflect their unique functions?

4. List two examples of active transport.

5. Describe how exocytosis occurs.

6. Describe the process of endocytosis.

7. Describe how endocytosis is of benefit to cells.

8. Compare active transport with osmosis.

9. Compare facilitated diffusion and active transport. How do they differ in terms of

a. energy needed

b. direction of movement across cell membranes?

10. What does the structure of DNA resemble?

A. Blueprints B. Triple chain C. Twisted ball D. Twisted ladder

11. Describe the basic structure of DNA.

A. Nucleotides attached together in a mass.

B. Nucleotides on the outside attached to phosphates in the inside.

C. Phosphate strands on the outside with nucleotides bonded together on the inside.

D Phosphate strands on the outside with nucleotides attached at every other junction.

12. Which component of a nucleotide carries the genetic information?

A. Deoxyribose sugar B. Hydrogen bond C. Nitrogenous base D. Phosphate group

13. Define the term “nucleotide” and describe its structural components.

14. Analyse how the structure of DNA in eukaryotic cells facilitates its role in genetic inheritance.

15. What is DNA replication, and why is it important for living organisms?

16. What are the major enzymes involved in DNA replication, and what functions do they perform?

17. What are the various stages of DNA replication, and how do they contribute to the overall process?

18. How can a designed model of the double helix structure of DNA be used to explain the process of DNA replication, including the roles of the leading and lagging strands?

19. What is RNA and what are its components?

20. Outline the stages involved in RNA transcription, and how they contribute to the process?

21. Why is RNA transcription crucial in living organisms?

22. How does RNA transcription influence protein synthesis?

23. How do the three types of RNA function, and what are their roles?

24. What is the basic structure of a nucleotide and its role in the genetic code?

25. Describe the process of transcription and its significance in protein synthesis.

26. Compare and contrast the processes of replication and transcription.

27. Describe the role of tRNA in translation.

28. How do ribosomes contribute to protein synthesis.

29. Discuss how the regulation of protein synthesis can affect cellular function.

30. Discuss the significance of RNA in ensuring the accuracy of protein synthesis.